Assignments AP CSP

Form: Period 3 Lab Links

Form: Period 5 Lab Links

 

Week 15: Dec 6 - Dec 10

• Classwork: Lab - Looping RPS (rock, paper, scissors game)
  
• Classwork: Lab - Single RPS (rock, paper, scissors game)
• Classwork: Live Coding (baby rocks game)
• Classwork: Live Code (overflow, underflow)
• Classwork: Binary Game
• Classwork: Live Coding (using a function to get action input for the conversion lab)
• Classwork: Lab - Conversions (submit to form when complete) - due Wed Dec 8
  - ask the user for a word or phrase, and also what conversion they would like (hex, deimal, binary)
  - convert and print with a message
  - put all of this in a loop
  
• Classwork: Live Code (simple conversion from ascii to decimal, binary & hex) - due Wed Dec 8
• Classwork: CodeHS Unit 8 Digital Information
  - 8.1 Intro to Digital Information
  - 8.2 Number Systems
  - 8.3 Encoding Bits with Binary

Week 14: Nov 29 - Dec 3

• Classwork: Live Coding (function to get action input for conversion)
• Classwork: Lab - Conversions (submit to form when complete)
  - ask the user for a word or phrase, and also what conversion they would like (hex, ascii, binary)
  - convert and print with a message
  - put all of this in a loop
• Classwork: CodeHS Unit 8 Digital Information
  - 8.1 Intro to Digital Information
  - 8.2 Number Systems
  - 8.3 Encoding Bits with Binary
• Classwork: Binary Game
• Classwork: Live Code (conversion to ascii, binary & hex)
• Classwork: Notes (function vs method, begin to collect examples)
• Classwork: CB Dec 1 (8 questions)
  - this one is not for a grade
• Classwork: Do Now - single letters
  - ask user for a word
  - print each letter of the word
  
  
• Classwork: Do Now - initials
  
  # ask use for name

  # print only initials as upper case
  
  
  
• Classwork: Delta Math - Nov_30 Assignment
• Classwork: Computing 101
  - Packet Switching Review
  - Computer Networks (do both Network Components and The Internet)
  
• Classwork: Review Check_In from last week
• Classwork: Notes (algorithm/abstraction, intro to binary)
• Classwork: Live Coding (local/global bad python, use of split(), list/string options - list, join)
• Classwork: CodeHS - Unit 5 Functions - by Thu Dec 2
  - 5.4 Functions and Return Values 1
  - 5.5 Functions and Return Values 2
• Classwork: CodeHS - Unit 11 Internet
  - 11.8 Sequential, Parallel, and Distributed Computing
  - 11.9 Cybersecurity - due Tue Nov 30
  - 11.10 The Impact of the Internet
  - 11. 11 Creative Credit & Copyright - due Thu Dec 2 (this will finish unit 11)

 

Week 13: Nov 22 - Nov 24

• Classwork: Pig-Latin (do now)
  - ask for phrase, first letter goes to the end and then add 'ay'
  - word in: hello, word out: ellohay
• Classwork: Check-In Mon Nov 22
• Classwork: Algorithms
• Classwork: Lab Calculator One - due before Wed Nov 24
  * to print an % in your output format it as: %%
• Classwork: CodeHS - Unit 11 Internet
  - 11.8 Sequential, Parallel, and Distributed Computing
  - 11.9 Cybersecurity - due Tue Nov 30
  - 11.10 The Impact of the Internet
  - 11. 11 Creative Credit & Copyright - due Thu Dec 2 (this will finish unit 11)

Week 12: Nov 15 - Nov 19

• Classwork: Lab Calculator One - due before Wed Nov 24
• Classwork: Lab Fahrenheit_One - due end of class on Fri Nov 19
• Resource: Python String Methods
• Classwork: Internet (review/notes)
• Classwork: Lab -Email_One - due by start of class Wed Nov 17
  

• Classwork: CodeHS Unit 11 - The Internet - due by start of class Mon Nov 22
  - 11.6 Routing
  - 11.7 Packets and Protocols
• Classwork: CodeHS Unit 11 - The Internet - due by start of class Wed Nov 17
  - 11.4 Viewing Websites
  - 11.5 DNS
• Classwork: CodeHS Unit 5 Functions and Parameters- these should really already be done...but also by start of class on Wed Nov 17
  - 5.1 Functions and Parameters 1
  - 5.2 Functions and Parameters 2

 

Week 11: Nov 8 - Nov 12

• Resource: Python String Methods
• Classwork: Lab -Email_One
• Classwork: Live Coding - locating an index value, slicing a string
• Classwork: CodeHS Unit 11 The Internet - due on Wed Nov 10
  * you can expect to see some of this vocabulary in a quiz on Friday....
  - 11.1 Welcome to the Internet
  - 11.2 Internet Hardware
  -11.3 Internet Addresses
• Classwork: Delta Math Nov _9
• Classwork: CodeHS Unit 5 Functions and Parameters
  - 5.1 Functions and Parameters 1
  - 5.2 Functions and Parameters 2

Week 10: Nov 1 - Nov 5

• Classwork: Nov 4 Check_In
• Homework: tech news (due before class on Thu Nov 4)
  - look for something about technology that provokes a discussion (pros/cons/usefulness/impacts)
  - submit information here: before class starts and be prepared to summarize the article and give your opinions
• Classwork: CodeHS Unit 5 Functions and Parameters
  - 5.1 Functions and Paramters 1
  - 5.2 Functions and Paramters 2
  
  
• Classwork: Lab Winter Things
• Classwork: Live Coding (lists: modify, insert, slice)
  
• Classwork/Homework: Lab - Famous People
  
• Classwork: Live Coding (lists - removing items, use of index)
• Classwork/Homework:Delta Math (Assignment Name: Oct 28) due by Wed Nov 3

Week 9: Oct 25 - Oct 29

• Classwork/Homework: Lab - (5 wallets)
• Classwork: Live Coding (max, min, sum, creating empty list, adding to a list)
• Lab - do now (in class) : DNA 1 - Counting
  data set:
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
• Lab - do now (in class): DNA 2 - Replace
  data set: GATGGAACTTGACTACGTAAATT
  
• Lab - do now (in class): DNA 3 - Complement (Optional Challenge)
  data set: AAAACCCGGT
• Classwork: Working with Strings (replace,& count functions - live coding)
• Resource: Introduction to Python
• Classwork: CodeHS
  - 4.10 While Loops (4.10.4 Inventory is optional)
  - 4.11 Loop and a Half - before Tue Oct 26
  

Week 8: Oct 18 - Oct 22

• Shirts - Order Form
  - Conversion Chart: Decimal - Binary - Octal - Hex – ASCII

• Classwork: Phishing Quiz
  - test yourself - can you pick out the phishing emails vs the legitimate ones?
  
  
• Complete: The Internet is for Everyone - Part I & Part II - due before Mon Oct 25
  - Vint Cerf wrote this memo in 2002 - do these challenges still exist today? How so?
  - read the documents and look at the 9 points for "The Internet is for everyone - but it won't be if..." and discuss the challenges laid out at the end
  - Written Reflection:
  - everyone will pick two of the challenges that are the most meaningful to you, or relate to some experience you've had - explain what you picked and explaine why - what is it about today that makes these challenges still something to work on. Give a thoughtful response - nothing vague please.
  - write this up in a new document that is inside of your AP CSP Folder
  ** there should be NO untitled documents in here - give your files a name so I know which assignments they are!

• Lab: Skittles - before Fri Oct 22
• Lab: Aliens - before Wed Oct 20
  - a random list of aliens just means a list that maybe someone else created so you don't already know who many of each exist ..
  
• Classwork: Working with Lists (live coding)
• Classwork: Binary Search (discussion & video)
• Classwork: Oct 18 - check in
  
• Classwork: CodeHS
  - 4. 8 For Loop Practice - before Monday Oct 18
        *** 4.8.4 Better Sum (has an error in their example - you may need help with this)
        *** 4.8.6 All Dice Values (needs a nested loop which you might need help with)
  - 4.9 Random Numbers- before Wed Oct 20
  - 4.10 While Loops (4.10.4 Inventory is optional)
  - 4.11 Loop and a Half - before Tue Oct 26

 

Week 7: Oct 12 - Oct 15

• Classwork: Live Coding (Intro to Lists)
• Classwork: Lab - Coins by Friday Oct 15
• Classwork: Do Now (birthday month) (in class)
  * code in repl.it and submit the link on our usual lab form
  - input: user name, birthday month (as a whole number)
  - output: a message greeting the user and confirming their birth month (in text format)
  - there should be only one if and one else statement - the rest should be elif
  - if the birthday month is invalid print a different message
  - when a lowercase name is entered format to a capital when printing
  
  
  
• Classwork: CodeHS
  - 4.6 For Loops in Python
  - 4.7 General For Loops - by Friday Oct 15
  - 4. 8 For Loop Practice - by Monday Oct 18
        *** 4.8.4 Better Sum (has an error in their example - you may need help with this)
        *** 4.8.6 All Dice Values (needs a nested loop which you might need help with)
  
  - 4.9 Random Numbers
  - 4.10 While Loops (4.10.4 Inventory is optional)
  - 4.11 Loop and a Half

 

Week 6: Oct 4 - Oct 8

DNS - Domain Name System
BGP - Border Gateway Protocol
ISP - Internet Service Provider

• Complete: Field Trip and Lunch forms
• Classwork: View "The Imitation Game"
• Classwork: Do Now (birthday month)
  * code in repl.it and submit the link on our usual lab form
  - input: user name, birthday month (as a whole number)
  - output: a message greeting the user and confirming their birth month (in text format)
  - there should be only one if and one else statement - the rest should be elif
  - if the birthday month is invalid print a different message
  - when a lowercase name is entered format to a capital when printing
  
  
  
• Classwork: CodeHS
  - 4.6 For Loops in Python
  - 4.7 General For Loops
  - 4. 8 For Loop Practice
  *** 4.8.6 all dice values needs a nested loop which you might need help with)
  - 4.9 Random Numbers
  - 4.10 While Loops (4.10.4 Inventory is optional)
  - 4.11 Loop and a Half

 

Week 5: Sep 27 - Oct 1

• Classwork: Computing 101
  - Print Commands
  - Computing Operators
• Classwork: Live Coding (modulo, printing with placeholders, and formatting output)
• Classwork: CodeHS
  - 4.1 Booleans
  - 4.2 Logical Operators
  - 4.3 Comparison Operators
  - 4.4 If Statements (by start of class Thu Sep 30)
• Classwork: Lab - Odd_Even (due before Tue Oct 5)
• Classwork: Lab - Tax Rate (due before Tue Oct 5)
  - note you can use your cash register code as a starting point
  - do not change your cash register program - just make a copy by "forking" it - yes, that is a real term
• Classwork: CodeHS
  - 4.6 For Loops in Python
  - 4.7 General For Loops
  - 4. 8 For Loop Practice
  - 4.9 Random Numbers
  - 4.10 While Loops (4.10.4 Inventory is optional)
  - 4.11 Loop and a Half
• Classwork: Delta Math (TDB)
• Classwork: Lab (TBD)

 

Week 4: Sep 20 - Sep 24

P E M M D A S
- parenthesis
- exponents
- modulo, multiplication, division (as they appear left to right)
- addition, subtraction (as they appear left to right)

• Classwork: Play Madlib Pair Programs
  - ML 1
  - ML 2
  - ML 3
  - ML 4
  - ML 5
  - ML 6
  - ML 7
  - ML 8
  - ML 9
  - ML 10
• Classwork: Delta Math
  https://www.deltamath.com/students?code=8XB2-ZC3G
  - Sep 22 practice (by start of class Fri Sep 24)
• Classwork: CodeHS
  - 4.1 Booleans
  - 4.2 Logical Operators
  - 4.3 Comparison Operators
  - 4.4 If Statements
• Classwork: MadLib Programs (pair)
  - write a python Mad Libs program
  - first come up with a short story
  - gather input from your user to fill in the blanks (noun, verb, adjective, etc)
  - use at least 1 string, 1 integer and 1 float for input data type
  - print out the story when done
  - use of formatting can be added to make the finished story more readable
  - submit your finished link (just copy the link from the URL bar... rather than making a join link)

  Form: Period 3 Lab Links

  Form: Period 5 Lab Links

• Classwork: Lab (Cash Register) (by start of class Fri Sep 24)
• Classwork: CodeHS
  - 3.5 input (by start of class Tue Sep 21)
  - 3.6 basic math (by start of class Thu Sep 23)

Week 3: Sep 13 - Sep 17

• College Board - make sure you are signed up for your section - guidance needs this to order the exams
  join College Board Classroom
  - Period 3 (493PZQ)
  - Period 5 (ARYVXV)
• Classwork: Mad Lib Program (pair) - start possibly
• Classwork: Live Coding - week_3_practice_2
  - input, casting, printing, variables inside of other variables
• Classwork: CodeHS
  - 3.5 input (by end of class Mon Sep 20)
  - 3.6 basic math
• Classwork: Live Coding - week_3_practice
  - string concatenation, capitalize & title functions tabs & new line characters, changing variable values
• Classwork: Share Interviews
• Classwork: CodeHS Unit 3 Programming with Python
  - 3.1 What is Code?
  - 3.2 Uses of Programs
  - 3.3 Hello World
  - 3.4 Variables - due by start of class Thu Sep 16
  

 

Week 2: Sep 7 - Sep10

• Homework: Interview (due for class meeting Mon Sep 13)
  - ask an adult to choose a technology that had an impact on their life
  - you do the same
  - try to answer the following for both of you: what about it was important? what benefit did it bring you? what changes did it bring about to your life that wouldn't happen if it didn't exist?
• News: 1st share for Period 5, follow-ups for Period 3
• View: Amazon Go video
  
• Classwork: CodeHS Unit 3 Programming with Python
  - 3.1 What is Code?
  - 3.2 Uses of Programs
  - 3.3 Hello World
  - 3.4 Variables
• Create: Repl.it Accounts
  - hello world practice program
• Classwork: Live Coding Practice
  - google doc for notes in your folder

 

Week 1: Sep 1 - Sep 2

• Slack - test out messages, change notification time settings
• join College Board Classroom
  - Period 3 (493PZQ)
  - Period 5 (ARYVXV)
• join CodeHS section (42991)
• Homework: tech news (due before class on Thu Sep 2)
  - look for something about technology that provokes a discussion (pros/cons/usefulness/impacts)
  - submit information here: beforeclass starts and be prepared to summarize the article and give your opinions

 

www.kellysclass.info - Sandwich High School
mkelly@sandwich.k12.ma.us
kellytechclass@gmail.com